bio-read-qc-fastp-workflow

All-in-one preprocessing tool that handles adapter trimming, quality filtering, deduplication, and report generation in a single pass.

Safety Notice

This listing is imported from skills.sh public index metadata. Review upstream SKILL.md and repository scripts before running.

Copy this and send it to your AI assistant to learn

Install skill "bio-read-qc-fastp-workflow" with this command: npx skills add gptomics/bioskills/gptomics-bioskills-bio-read-qc-fastp-workflow

fastp Workflow

All-in-one preprocessing tool that handles adapter trimming, quality filtering, deduplication, and report generation in a single pass.

Basic Usage

Single-End

fastp -i input.fastq.gz -o output.fastq.gz

Paired-End

fastp -i R1.fastq.gz -I R2.fastq.gz -o R1_clean.fastq.gz -O R2_clean.fastq.gz

With Custom HTML/JSON Reports

fastp -i R1.fq.gz -I R2.fq.gz
-o R1_clean.fq.gz -O R2_clean.fq.gz
-h sample_report.html
-j sample_report.json

Adapter Trimming

fastp auto-detects Illumina adapters by default.

Auto-detect (default)

fastp -i in.fq -o out.fq

Specify adapters manually

fastp -i in.fq -o out.fq
--adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA

Paired-end with manual adapters

fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq
--adapter_sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA
--adapter_sequence_r2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Disable adapter trimming

fastp -i in.fq -o out.fq --disable_adapter_trimming

Adapter FASTA file

fastp -i in.fq -o out.fq --adapter_fasta adapters.fa

Quality Filtering

Per-base quality threshold (default Q15)

fastp -i in.fq -o out.fq -q 20

Mean read quality threshold

fastp -i in.fq -o out.fq -e 25

Max unqualified bases percent (default 40)

fastp -i in.fq -o out.fq -q 20 --unqualified_percent_limit 30

Disable quality filtering

fastp -i in.fq -o out.fq --disable_quality_filtering

Quality Trimming

Sliding window from 3' end (recommended)

fastp -i in.fq -o out.fq
--cut_right
--cut_right_window_size 4
--cut_right_mean_quality 20

Sliding window from 5' end

fastp -i in.fq -o out.fq
--cut_front
--cut_front_window_size 4
--cut_front_mean_quality 20

Both ends

fastp -i in.fq -o out.fq
--cut_front --cut_tail
--cut_front_window_size 4
--cut_front_mean_quality 20
--cut_tail_window_size 4
--cut_tail_mean_quality 20

Length Filtering

Minimum length (default 15)

fastp -i in.fq -o out.fq -l 36

Maximum length

fastp -i in.fq -o out.fq --length_limit 150

Required length (discard shorter AND longer)

fastp -i in.fq -o out.fq -l 100 --length_limit 100

Poly-X Trimming

Trim poly-G (NovaSeq/NextSeq artifacts) - auto-enabled for these platforms

fastp -i in.fq -o out.fq --trim_poly_g

Disable poly-G trimming

fastp -i in.fq -o out.fq --disable_trim_poly_g

Trim poly-X (any homopolymer)

fastp -i in.fq -o out.fq --trim_poly_x

Custom poly-G minimum length (default 10)

fastp -i in.fq -o out.fq --trim_poly_g --poly_g_min_len 5

N Base Handling

Max N bases (default 5)

fastp -i in.fq -o out.fq -n 3

Disable N filtering

fastp -i in.fq -o out.fq --n_base_limit 50

Deduplication

Enable deduplication

fastp -i in.fq -o out.fq --dedup

Accuracy level (1-6, higher = more memory, default 3)

fastp -i in.fq -o out.fq --dedup --dup_calc_accuracy 4

Base Correction (Paired-End Only)

Enable overlap-based correction

fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq --correction

Required overlap length (default 30)

fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq
--correction --overlap_len_require 20

Paired-End Merge

Merge overlapping paired reads

fastp -i R1.fq -I R2.fq
--merge --merged_out merged.fq
-o R1_unmerged.fq -O R2_unmerged.fq

UMI Processing

UMI in read (extract to header)

fastp -i in.fq -o out.fq
--umi --umi_loc read1 --umi_len 8

UMI in separate read

fastp -i R1.fq -I R2.fq -o R1.out.fq -O R2.out.fq
--umi --umi_loc index1

UMI locations: index1, index2, read1, read2, per_index, per_read

Complete Workflow Example

Standard Illumina Pipeline

fastp
-i raw_R1.fastq.gz -I raw_R2.fastq.gz
-o clean_R1.fastq.gz -O clean_R2.fastq.gz
--detect_adapter_for_pe
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20
-q 20 -l 36
--thread 8
-h sample_fastp.html -j sample_fastp.json

NovaSeq/NextSeq Pipeline

fastp
-i raw_R1.fastq.gz -I raw_R2.fastq.gz
-o clean_R1.fastq.gz -O clean_R2.fastq.gz
--detect_adapter_for_pe
--trim_poly_g
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20
-q 20 -l 36
--thread 8
-h sample_fastp.html -j sample_fastp.json

RNA-seq Pipeline

fastp
-i raw_R1.fastq.gz -I raw_R2.fastq.gz
-o clean_R1.fastq.gz -O clean_R2.fastq.gz
--detect_adapter_for_pe
--cut_right --cut_right_window_size 4 --cut_right_mean_quality 20
-q 20 -l 50
--thread 8
-h sample_fastp.html -j sample_fastp.json

Output Files

File Description

*.html

Interactive HTML report

*.json

Machine-readable statistics

Output FASTQ Processed reads

JSON Report Structure

import json

with open('sample_fastp.json') as f: report = json.load(f)

summary = report['summary'] print(f"Total reads: {summary['before_filtering']['total_reads']}") print(f"Passed reads: {summary['after_filtering']['total_reads']}") print(f"Q20 rate: {summary['after_filtering']['q20_rate']:.2%}") print(f"Q30 rate: {summary['after_filtering']['q30_rate']:.2%}")

Performance

Set threads (default 3)

fastp -i in.fq -o out.fq --thread 8

Disable HTML report (faster)

fastp -i in.fq -o out.fq --html /dev/null

Process from stdin

zcat in.fq.gz | fastp --stdin -o out.fq

Related Skills

  • quality-reports - MultiQC can aggregate fastp JSON reports

  • adapter-trimming - Cutadapt for complex adapter scenarios

  • quality-filtering - Trimmomatic alternative

Source Transparency

This detail page is rendered from real SKILL.md content. Trust labels are metadata-based hints, not a safety guarantee.

Related Skills

Related by shared tags or category signals.

Automation

bio-workflow-management-snakemake-workflows

No summary provided by upstream source.

Repository SourceNeeds Review
Automation

bio-workflow-management-cwl-workflows

No summary provided by upstream source.

Repository SourceNeeds Review
Automation

bio-workflows-rnaseq-to-de

No summary provided by upstream source.

Repository SourceNeeds Review
Automation

bio-workflows-microbiome-pipeline

No summary provided by upstream source.

Repository SourceNeeds Review